RAB22A cDNA

Artikelnummer: USB-552206
Artikelname: RAB22A cDNA
Artikelnummer: USB-552206
Hersteller Artikelnummer: 552206
Alternativnummer: USB-552206-10
Hersteller: US Biological
Kategorie: Molekularbiologie
The protein encoded by RAB22A is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 585bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGCTGAGGGAGCTCAAAGTGTGTCTGCTCGGGGATACAGGTGTAGGTAAATCGAGTATTGTGTGGCGGTTTGTGGAAGACAGTTTTGATCCAAACATCAACCCAACAATAGGGGCATCTTTTATGACCAAGACTGTCCAGTACCAAAATGAGCTACATAAATTCCTAATCTGGGATACAGCTGGACAAGAACGATTTCGTGCCTTAGCACCAATGTACTATCGAGGGTCGGCTGCAGCTATAATCGTTTATGATATCACAAAAGAAGAGACATTTTCAACATTAAAGAATTGGGTGAAAGAGCTTCGACAGCATGGCCCACCTAATATTGTAGTTGCCATTGCAGGAAATAAATGTGATCTTATCGATGTAAGAGAAGTCATGGAGAGAGATGCAAAGGACTACGCCGACTCTATTCATGCAATTTTTGTAGAGACCAGCGCAAAAAACGCGATAAACATAAATGAACTCTTTATAGAAATTAGTCGAAGAATTCCATCCACTGACGCCAACCTGCCATCTGGCGGTAAGGGCTTCAAACTCCGAAGACAGCCTTCAGAGCCAAAGCGGAGCTGCTGCTGA Translation Sequence: MALRELKVCL LGDTGVGKSS IVWRFVEDSF DPNINPTIGA SFMTKTVQYQ NELHKFLIWD TAGQERFRAL APMYYRGSAA AIIVYDITKE ETFSTLKNWV KELRQHGPPN IVVAIAGNKC DLIDVREVME RDAKDYADSI HAIFVETSAK NAININELFI EISRRIPSTD ANLPSGGKGF KLRRQPSEPK RSCC Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 065724
Formulierung: Supplied as a lyophilized powder.