RAB35 cDNA

Artikelnummer: USB-552212
Artikelname: RAB35 cDNA
Artikelnummer: USB-552212
Hersteller Artikelnummer: 552212
Alternativnummer: USB-552212-10
Hersteller: US Biological
Kategorie: Molekularbiologie
The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. That Rab is involved in the process of endocytosis and is an essential rate-limiting regulator of the fast recycling pathway back to the plasma membrane. During cytokinesis, required for the postfurrowing terminal steps, namely for intercellular bridge stability and abscission, possibly by controlling phosphatidylinositol 4, 5-bis phosphate (PIP2) and SEPT2 localization at the intercellular bridge. May indirectly regulate neurite outgrowth. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 624bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCCGGGACTACGACCACCTCTTCAAGCTGCTCATCATCGGCGACAGCGGTGTGGGCAAGAGCAGTTTACTGTTGCGTTTTGCAGACAACACTTTCTCAGGCAGCTACATCACCACGATCGGAGTGGATTTCAAGATCCGGACCGTGGAGATCAACGGGGAGAAGGTGAAGCTGCAGATCTGGGACACAGCGGGGCAGGAGCGCTTCCGCACCATCACCTCCACGTATTATCGGGGGACCCACGGGGTCATTGTGGTTTACGACGTCACCAGTGCCGAGTCCTTTGTCAACGTCAAGCGGTGGCTTCACGAAATCAACCAGAACTGTGATGATGTGTGCCGAATATTAGTGGGTAATAAGAATGACGACCCTGAGCGGAAGGTGGTGGAGACGGAAGATGCCTACAAATTCGCCGGGCAGATGGGCATCCAGTTGTTCGAGACCAGCGCCAAGGAGAATGTCAACGTGGAAGAGATGTTCAACTGCATCACGGAGCTGGTCCTCCGAGCAAAGAAAGACAACCTGGCAAAACAGCAGCAGCAACAACAGAACGATGTGGTGAAGCTCACGAAGAACAGTAAACGAAAGAAACGCTGCTGCTAA Translation Sequence: MARDYDHLFK LLIIGDSGVG KSSLLLRFAD NTFSGSYITT IGVDFKIRTV EINGEKVKLQIWDTAGQERF RTITSTYYRG THGVIVVYDV TSAESFVNVK RWLHEINQNC DDVCRILVGNKNDDPERKVV ETEDAYKFAG QMGIQLFETS AKENVNVEEM FNCITELVLR AKKDNLAKQQQQQQNDVVKL TKNSKRKKRC C Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 006852
Formulierung: Supplied as a lyophilized powder.