RAB6A cDNA

Artikelnummer: USB-552218
Artikelname: RAB6A cDNA
Artikelnummer: USB-552218
Hersteller Artikelnummer: 552218
Alternativnummer: USB-552218-10
Hersteller: US Biological
Kategorie: Molekularbiologie
RAB6A encodes a member of the RAB family, which belongs to the small GTPase superfamily. GTPases of the RAB family bind to various effectors to regulate the targeting and fusion of transport carriers to acceptor compartments. RAB6A is located at the Golgi apparatus, which regulates trafficking in both a retrograde (from early endosomes and Golgi to the endoplasmic reticulum) and an anterograde (from the Golgi to the plasma membrane) directions. Myosin II is an effector of this protein in these processes. RAB6A is also involved in assembly of human cytomegalovirus (HCMV) by interacting with the cellular protein Bicaudal D1, which interacts with the HCMV virion tegument protein, pp150. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 627bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCCACGGGCGGAGACTTCGGGAATCCGCTGAGGAAATTCAAGCTGGTGTTCCTGGGGGAGCAAAGCGTTGGAAAGACATCTTTGATCACCAGATTCATGTATGACAGTTTTGACAACACCTATCAGGCAACAATTGGCATTGACTTTTTATCAAAAACTATGTACTTGGAGGATCGAACAATCAGGCTTCAGCTGTGGGATACTGCGGGTCAGGAACGTTTCCGTAGCCTCATTCCCAGTTACATCCGTGATTCTGCTGCAGCTGTAGTAGTTTACGATATCACAAATGTTAACTCATTCCAGCAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAAGTGATGTTATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGACAAGAGGCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGAAACTAGTGCAAAAGCTGGATACAATGTAAAGCAGCTCTTTCGACGTGTAGCAGCAGCTTTGCCGGGAATGGAAAGCACACAGGACAGAAGCAGAGAAGATATGATTGACATAAAACTGGAAAAGCCTCAGGAGCAACCAGTCAGTGAAGGAGGCTGTTCCTGCTAA Translation Sequence: MSTGGDFGNP LRKFKLVFLG EQSVGKTSLI TRFMYDSFDN TYQATIGIDF LSKTMYLEDRTIRLQLWDTA GQERFRSLIP SYIRDSAAAV VVYDITNVNS FQQTTKWIDD VRTERGSDVIIMLVGNKTDL ADKRQVSIEE GERKAKELNV MFIETSAKAG YNVKQLFRRV AAALPGMESTQDRSREDMID IKLEKPQEQP VSEGGCSC Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 002860
Formulierung: Supplied as a lyophilized powder.