Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 2 belongs to this family. RGS2 acts as a mediator of myeloid differentiation and may play a role in leukemogenesis. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 636bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCAAAGTGCTATGTTCTTGGCTGTTCAACACGACTGCAGACCCATGGACAAGAGCGCAGGCAGTGGCCACAAGAGCGAGGAGAAGCGAGAAAAGATGAAACGGACCCTTTTAAAAGATTGGAAGACCCGTTTGAGCTACTTCTTACAAAATTCCTCTACTCCTGGGAAGCCCAAAACCGGCAAAAAAAGCAAACAGCAAGCTTTCATCAAGCCTTCTCCTGAGGAAGCACAGCTGTGGTCAGAAGCATTTGACGAGCTGCTAGCCAGCAAATATGGTCTTGCTGCATTCAGGGCTTTTTTAAAGTCGGAATTCTGTGAAGAAAATATTGAATTCTGGCTGGCCTGTGAAGACTTCAAAAAAACCAAATCACCCCAAAAGCTGTCCTCAAAAGCAAGGAAAATATATACTGACTTCATAGAAAAGGAAGCTCCAAAAGAGATAAACATAGATTTTCAAACCAAAACTCTGATTGCCCAGAATATACAAGAAGCTACAAGTGGCTGCTTTACAACTGCCCAGAAAAGGGTATACAGCTTGATGGAGAACAACTCTTATCCTCGTTTCTTGGAGTCAGAATTCTACCAGGACTTGTGTAAAAAGCCACAAATCACCACAGAGCCTCATGCTACATGA Translation Sequence: MQSAMFLAVQ HDCRPMDKSA GSGHKSEEKR EKMKRTLLKD WKTRLSYFLQ NSSTPGKPKTGKKSKQQAFI KPSPEEAQLW SEAFDELLAS KYGLAAFRAF LKSEFCEENI EFWLACEDFKKTKSPQKLSS KARKIYTDFI EKEAPKEINI DFQTKTLIAQ NIQEATSGCF TTAQKRVYSLMENNSYPRFL ESEFYQDLCK KPQITTEPHA T Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
