SCAND1 encodes a SCAN box domain-containing protein. The SCAN domain is a highly conserved, leucine-rich motif of approximately 60aa originally found within a subfamily of zinc finger proteins. This gene belongs to a family of genes that encode an isolated SCAN domain, but no zinc finger motif. This protein binds to and may regulate the function of the transcription factor myeloid zinc finger 1B. Alternate splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 540bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGCTACGGAGCCGATCTTGGCGGCCACTGGGAGTCCCGCGGCGGTGCCACCGGAGAAACTGGAAGGAGCCGGTTCGAGCTCAGCCCCTGAGCGTAACTGTGTGGGCTCCTCGCTGCCAGAGGCCTCACCGCCTGCCCCTGAGCCTTCCAGTCCCAACGCCGCGGTCCCTGAAGCCATCCCTACGCCCCGAGCTGCGGCCTCCGCGGCCCTGGAGCTGCCTCTCGGGCCCGCACCCGTGAGCGTAGCGCCTCAGGCCGAAGCTGAAGCGCGCTCCACACCAGGCCCCGCCGGCTCTAGACTCGGTCCCGAGACGTTCCGCCAGCGTTTCCGGCAGTTCCGCTACCAGGATGCGGCGGGTCCCCGGGAGGCTTTCCGGCAGCTGCGGGAGCTGTCCCGCCAGTGGCTGCGGCCTGACATCCGCACCAAGGAGCAGATCGTGGAGATGCTGGTGCAAGAGCAGCTGCTCGCCATCCTGCCCGAGGCGGCTCGGGCCCGGCGGATCCGCCGCCGCACGGATGTGCGCATCACTGGCTGA Translation Sequence: MAATEPILAA TGSPAAVPPE KLEGAGSSSA PERNCVGSSL PEASPPAPEP SSPNAAVPEA IPTPRAAASA ALELPLGPAP VSVAPQAEAE ARSTPGPAGS RLGPETFRQR FRQFRYQDAA GPREAFRQLR ELSRQWLRPD IRTKEQIVEM LVQEQLLAIL PEAARARRIR RRTDVRITG Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
