SF3B6 cDNA

Artikelnummer: USB-552280
Artikelname: SF3B6 cDNA
Artikelnummer: USB-552280
Hersteller Artikelnummer: 552280
Alternativnummer: USB-552280-10
Hersteller: US Biological
Kategorie: Molekularbiologie
SF3B14 encodes a 14kD protein subunit of the splicing factor 3b complex. Splicing factor 3b associates with both the U2 and U11/U12 small nuclear ribonucleoprotein complexes (U2 snRNP) of spliceosomes. This 14kD protein interacts directly with subunit 1 of the splicing factor 3b complex. This 14kD protein also interacts directly with the adenosine that carries out the first transesterification step of splicing at the pre-mRNA branch site. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 378bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGATGCAAGCGGCCAAGAGGGCGAACATTCGACTTCCACCTGAAGTAAATCGGATATTGTATATAAGAAATTTGCCATACAAAATCACAGCTGAAGAAATGTATGATATATTTGGGAAATATGGACCTATTCGTCAAATCAGAGTGGGGAACACACCTGAAACTAGAGGAACAGCTTATGTGGTCTATGAGGACATCTTTGATGCCAAGAATGCATGTGATCACCTATCGGGATTCAATGTTTGTAACAGATACCTTGTGGTTTTGTACTATAATGCCAACAGGGCATTTCAGAAGATGGACACAAAGAAGAAGGAGGAACAGTTGAAGCTTCTCAAGGAGAAATATGGCATCAACACAGATCCACCAAAATAA Translation Sequence: MAMQAAKRAN IRLPPEVNRI LYIRNLPYKI TAEEMYDIFG KYGPIRQIRV GNTPETRGTA YVVYEDIFDA KNACDHLSGF NVCNRYLVVL YYNANRAFQK MDTKKKEEQL KLLKEKYGIN TDPPK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 057131
Formulierung: Supplied as a lyophilized powder.