SPA17 encodes a protein present at the cell surface. The N-terminus has sequence similarity to human cAMP-dependent protein kinase A (PKA) type II alpha regulatory subunit (RIIa) while the C-terminus has an IQ calmodulin-binding motif. The central portion of the protein has carbohydrate binding motifs and likely functions in cell-cell adhesion. A retrotransposed pseudogene is present on chromosome 10q22. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 456bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCGATTCCATTCTCCAACACCCACTACCGAATTCCACAAGGATTTGGGAATCTTCTTGAAGGGCTGACACGCGAGATTCTGAGAGAGCAACCGGACAATATACCAGCTTTTGCAGCAGCCTATTTTGAGAGCCTTCTAGAGAAAAGAGAGAAAACCAACTTTGATCCAGCAGAATGGGGGAGTAAGGTAGAAGACCGCTTCTATAACAATCATGCATTCGAGGAGCAAGAACCACCTGAGAAAAGTGATCCTAAACAAGAAGAGTCTCAGATATCTGGGAAGGAGGAAGAGACATCAGTCACCATCTTAGACTCTTCTGAGGAAGATAAGGAAAAAGAAGAGGTTGCTGCTGTCAAAATCCAAGCTGCCTTCCGGGGACACATAGCCAGAGAGGAGGCAAAGAAAATGAAAACAAATAGTCTTCAAAATGAGGAAAAAGAGGAAAACAAGTGA Translation Sequence: MSIPFSNTHY RIPQGFGNLL EGLTREILRE QPDNIPAFAA AYFESLLEKR EKTNFDPAEW GSKVEDRFYN NHAFEEQEPP EKSDPKQEES QISGKEEETS VTILDSSEED KEKEEVAAVK IQAAFRGHIA REEAKKMKTN SLQNEEKEEN K Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
