SRSF7 cDNA

Artikelnummer: USB-552299
Artikelname: SRSF7 cDNA
Artikelnummer: USB-552299
Hersteller Artikelnummer: 552299
Alternativnummer: USB-552299-10
Hersteller: US Biological
Kategorie: Molekularbiologie
SRSF7 is a member of the serine/arginine (SR) -rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. Two transcript variants encoding different isoforms have been found for SFSF7. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 717bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCGCGTTACGGGCGGTACGGAGGAGAAACCAAGGTGTATGTTGGTAACCTGGGAACTGGCGCTGGCAAAGGAGAGTTAGAAAGGGCTTTCAGTTATTATGGTCCTTTAAGAACTGTATGGATTGCGAGAAATCCTCCAGGATTTGCCTTTGTGGAATTCGAAGATCCTAGAGATGCAGAAGATGCAGTACGAGGACTGGATGGAAAGGTGATTTGTGGCTCCCGAGTGAGGGTTGAACTATCGACAGGCATGCCTCGGAGATCACGTTTTGATAGACCACCTGCCCGACGTCCCTTTGATCCAAATGATAGATGCTATGAGTGTGGCGAAAAGGGACATTATGCTTATGATTGTCATCGTTACAGCCGGCGAAGAAGAAGCAGGTCACGGTCTAGATCACATTCTCGATCCAGAGGAAGGCGATACTCTCGCTCACGCAGCAGGAGCAGGGGACGAAGGTCAAGGTCAGCATCTCCTCGACGATCAAGATCTATCTCTCTTCGTAGATCAAGATCAGCTTCACTCAGAAGATCTAGGTCTGGTTCTATAAAAGGATCGAGGTATTTCCAATCCCCGTCGAGGTCAAGATCAAGATCCAGGTCTATTTCACGACCAAGAAGCAGCCGATCAAAGTCCAGATCTCCATCTCCAAAAAGAAGTCGTTCCCCATCAGGAAGTCCTCGCAGAAGTGCAAGTCCTGAAAGAATGGACTGA Translation Sequence: MSRYGRYGGE TKVYVGNLGT GAGKGELERA FSYYGPLRTV WIARNPPGFA FVEFEDPRDAEDAVRGLDGK VICGSRVRVE LSTGMPRRSR FDRPPARRPF DPNDRCYECG EKGHYAYDCHRYSRRRRSRS RSRSHSRSRG RRYSRSRSRS RGRRSRSASP RRSRSISLRR SRSASLRRSRSGSIKGSRYF QSPSRSRSRS RSISRPRSSR SKSRSPSPKR SRSPSGSPRR SASPERMD Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001026854
Formulierung: Supplied as a lyophilized powder.