The product of SSX4 belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. SSX4 may function as transcriptional repressors. SSX4 are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t (X,18) translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. SSX4, represents the more telomeric copy. Two transcript variants encoding distinct isoforms have been identified for SSX4. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 567bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAACGGAGACGACGCCTTTGCAAGGAGACCCAGGGATGATGCTCAAATATCAGAGAAGTTACGAAAGGCCTTCGATGATATTGCCAAATACTTCTCTAAGAAAGAGTGGGAAAAGATGAAATCCTCGGAGAAAATCGTCTATGTGTATATGAAGCTAAACTATGAGGTCATGACTAAACTAGGTTTCAAGGTCACCCTCCCACCTTTCATGCGTAGTAAACGGGCTGCAGACTTCCACGGGAATGATTTTGGTAACGATCGAAACCACAGGAATCAGGTTGAACGTCCTCAGATGACTTTCGGCAGCCTCCAGAGAATCTTCCCGAAGATCATGCCCAAGAAGCCAGCAGAGGAAGAAAATGGTTTGAAGGAAGTGCCAGAGGCATCTGGCCCACAAAATGATGGGAAACAGCTGTGCCCCCCGGGAAATCCAAGTACCTTGGAGAAGATTAACAAGACATCTGGACCCAAAAGGGGGAAACATGCCTGGACCCACAGACTGCGTGAGAGAAAGCAGCTGGTGGTTTATGAAGAGATCAGCGACCCTGAGGAAGATGACGAGTAA Translation Sequence: MNGDDAFARR PRDDAQISEK LRKAFDDIAK YFSKKEWEKM KSSEKIVYVY MKLNYEVMTKLGFKVTLPPF MRSKRAADFH GNDFGNDRNH RNQVERPQMT FGSLQRIFPK IMPKKPAEEENGLKEVPEAS GPQNDGKQLC PPGNPSTLEK INKTSGPKRG KHAWTHRLRE RKQLVVYEEISDPEEDDE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.