cDNA Size: 240bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGCGATCTCGGCTCACTGCAACCTCTGTCTCCCAGGTTCAGGAAAATGGCTTTGTAAAGAAGCTTGAGCCTAAATCTGGCTGGATGACTTTTCTAGAAGTTACAGGAAAGATCTGTGAAATGCTCTTCTGTCCTGAAGCAATACTGTTGACCAGAAAGGACACTCCATATTGTGAAACCGGCCTAATTTTTCTGACTCTTACGAAAACGATTGCCAACACATACTTCTACTTTTAA Translation Sequence: MARSRLTATS VSQVQENGFV KKLEPKSGWM TFLEVTGKIC EMLFCPEAIL LTRKDTPYCE TGLIFLTLTK TIANTYFYF Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
