TAL2 cDNA

Artikelnummer: USB-552317
Artikelname: TAL2 cDNA
Artikelnummer: USB-552317
Hersteller Artikelnummer: 552317
Alternativnummer: USB-552317-10
Hersteller: US Biological
Kategorie: Molekularbiologie
TAL1 (also designated SCL) is a serine phosphoprotein and basic helix-loop-helix transcription factor known to regulate embryonic hematopoiesis. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 327bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGACCAGGAAGATCTTCACAAATACCAGGGAGCGGTGGAGGCAGCAGAATGTCAACAGCGCCTTTGCCAAGCTGAGGAAGCTCATCCCCACTCACCCTCCAGACAAAAAGCTGAGCAAAAATGAAACGCTTCGCCTGGCAATGAGGTATATCAACTTCTTGGTCAAGGTCTTGGGGGAGCAAAGCCTGCAACAAACGGGAGTGGCTGCTCAGGGGAACATTCTGGGGCTCTTCCCTCAAGGACCCCACCTGCCAGGCCTGGAGGACAGAACTCTGCTTGAGAACTACCAGGTTCCTTCACCTGGTCCAAGCCACCACATTCCTTAG Translation Sequence: MTRKIFTNTR ERWRQQNVNS AFAKLRKLIP THPPDKKLSK NETLRLAMRY INFLVKVLGEQSLQQTGVAA QGNILGLFPQ GPHLPGLEDR TLLENYQVPS PGPSHHIP Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 005412
Formulierung: Supplied as a lyophilized powder.