THRSP is similar to the gene product of S14, a rat gene whose expression is limited to liver and adipose tissue and is controlled by nutritional and hormonal factors. This gene has been shown to be expressed in liver and adipocytes, particularly in lipomatous modules. It is also found to be expressed in lipogenic breast cancers, which suggests a role in controlling tumor lipid metabolism. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 441bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCAGGTGCTAACCAAGCGTTACCCCAAGAACTGCCTGCTGACCGTCATGGACCGGTATGCAGCCGAGGTGCACAACATGGAGCAGGTGGTGATGATCCCCAGCCTTCTGCGGGACGTGCAGCTGAGTGGGCCTGGGGGCCAGGCCCAGGCTGAGGCCCCTGATCTCTACACCTACTTCACCATGCTCAAGGCCATCTGTGTGGATGTGGACCATGGGCTGCTGCCGCGGGAGGAGTGGCAGGCCAAGGTGGCAGGCAGCGAAGAGAATGGAACCGCAGAGACAGAGGAAGTCGAGGACGAGAGTGCCTCAGGAGAGCTGGACCTGGAAGCCCAGTTCCACCTGCACTTCTCCAGCCTCCATCACATCCTCATGCACCTCACCGAGAAAGCCCAGGAGGTGACAAGGAAATACCAGGAAATGACGGGACAAGTTTGGTAG Translation Sequence: MQVLTKRYPK NCLLTVMDRY AAEVHNMEQV VMIPSLLRDV QLSGPGGQAQ AEAPDLYTYFTMLKAICVDV DHGLLPREEW QAKVAGSEEN GTAETEEVED ESASGELDLE AQFHLHFSSLHHILMHLTEK AQEVTRKYQE MTGQVW Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.