TWIST2 cDNA

Artikelnummer: USB-552341
Artikelname: TWIST2 cDNA
Artikelnummer: USB-552341
Hersteller Artikelnummer: 552341
Alternativnummer: USB-552341-10
Hersteller: US Biological
Kategorie: Molekularbiologie
TWIST2 is a basic helix-loop-helix type transcription factor and shares similarity with Twist. It may inhibit osteoblast maturation and maintain cells in a preosteoblast phenotype during osteoblast development. Mutations in this gene cause focal facial dermal dysplasia 3, Setleis type. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 483bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGAGGAGGGCTCCAGCTCGCCCGTGTCCCCCGTGGACAGCCTGGGCACCAGCGAGGAGGAGCTCGAGAGGCAGCCCAAGCGCTTCGGCCGGAAGCGGCGCTACAGCAAGAAGTCGAGCGAAGATGGCAGCCCGACCCCGGGCAAGCGCGGCAAGAAGGGCAGCCCCAGCGCGCAGTCCTTCGAGGAGCTGCAGAGCCAGCGCATCCTGGCCAACGTGCGCGAGCGCCAGCGCACCCAGTCGCTCAACGAGGCCTTCGCGGCGCTGCGCAAGATCATCCCCACGCTGCCCTCTGACAAGCTGAGCAAGATCCAGACGCTCAAGCTGGCCGCCAGGTACATAGACTTCCTCTACCAGGTCCTGCAGAGCGACGAGATGGACAATAAGATGACCAGCTGCAGCTACGTGGCCCACGAGCGCCTCAGCTACGCCTTCTCCGTGTGGCGCATGGAGGGCGCGTGGTCCATGTCCGCCTCCCACTAG Translation Sequence: MEEGSSSPVS PVDSLGTSEE ELERQPKRFG RKRRYSKKSS EDGSPTPGKR GKKGSPSAQS FEELQSQRIL ANVRERQRTQ SLNEAFAALR KIIPTLPSDK LSKIQTLKLA ARYIDFLYQV LQSDEMDNKM TSCSYVAHER LSYAFSVWRM EGAWSMSASH Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 476527
Formulierung: Supplied as a lyophilized powder.