U2AF1L4 is a RNA-binding protein that function as a pre-mRNA splicing factor. It plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3-splice site selection. U2AF1L4 acts by enhancing the binding of U2AF2 to weak pyrimidine tracts and also participates in the regulation of alternative pre-mRNA splicing. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 546bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCTGAATATTTAGCTTCGATATTCGGGACTGAGAAGGACAAGGTTAACTGCTCTTTTTACTTTAAGATCGGGGTCTGCCGGCACGGGGACCGGTGCTCCCGGCTTCACAACAAGCCGACATTCAGCCAGGAGGTGTTCACAGAACTGCAGGAGAAGTATGGGGAGATTGAAGAGATGAATGTGTGCGACAACCTTGGGGACCACCTCGTGGGCAACGTCTATGTCAAGTTCCGGAGGGAGGAGGATGGAGAGCGGGCCGTGGCTGAACTCAGTAACCGCTGGTTCAACGGGCAGGCTGTGCACGGTGAGCTGTCTCCTGTCACTGACTTCCGGGAGTCATGCTGTCGCCAGTATGAGATGGGGGAATGTACCCGAGGTGGCTTCTGCAACTTCATGCATCTGCGGCCCATTTCCCAGAACCTCCAGAGGCAGCTCTATGGGCGGGGACCCAGGCGCAGGTCACCCCCGAGGTTCCATACTGGCCACCATCCCCGAGAGAGGAACCATCGGTGTTCCCCTGATCACTGGCATGGCCGCTTCTGA Translation Sequence: MAEYLASIFG TEKDKVNCSF YFKIGVCRHG DRCSRLHNKP TFSQEVFTEL QEKYGEIEEMNVCDNLGDHL VGNVYVKFRR EEDGERAVAE LSNRWFNGQA VHGELSPVTD FRESCCRQYEMGECTRGGFC NFMHLRPISQ NLQRQLYGRG PRRRSPPRFH TGHHPRERNH RCSPDHWHGRF Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.