UBE2B cDNA

Artikelnummer: USB-552347
Artikelname: UBE2B cDNA
Artikelnummer: USB-552347
Hersteller Artikelnummer: 552347
Alternativnummer: USB-552347-10
Hersteller: US Biological
Kategorie: Molekularbiologie
UBE2B (Ubiquitin-Conjugating Enzyme E2B) is a Protein Coding gene. Among its related pathways are TGF-Beta Pathway and Class I MHC mediated antigen processing and presentation. GO annotations related to this gene include ubiquitin-protein transferase activity and ubiquitin protein ligase binding. An important paralog of this gene is UBE2A. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 459bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCGACCCCGGCCCGGAGGAGGCTCATGCGGGATTTCAAGCGGTTACAAGAGGACCCACCTGTGGGTGTCAGTGGCGCACCATCTGAAAACAACATCATGCAGTGGAATGCAGTTATATTTGGACCAGAAGGGACACCTTTTGAAGATGGTACTTTTAAACTAGTAATAGAATTTTCTGAAGAATATCCAAATAAACCACCAACTGTTAGGTTTTTATCCAAAATGTTTCATCCAAATGTGTATGCTGATGGTAGCATATGTTTAGATATCCTTCAGAATCGATGGAGTCCAACATATGATGTATCTTCTATCTTAACATCAATTCAGTCTCTGCTGGATGAACCGAATCCTAACAGTCCAGCCAATAGCCAGGCAGCACAGCTTTATCAGGAAAACAAACGAGAATATGAGAAAAGAGTTTCGGCCATTGTTGAACAAAGCTGGAATGATTCATAA Translation Sequence: MSTPARRRLM RDFKRLQEDP PVGVSGAPSE NNIMQWNAVI FGPEGTPFED GTFKLVIEFS EEYPNKPPTV RFLSKMFHPN VYADGSICLD ILQNRWSPTY DVSSILTSIQ SLLDEPNPNS PANSQAAQLY QENKREYEKR VSAIVEQSWN DS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 003328
Formulierung: Supplied as a lyophilized powder.