UBE2K cDNA

Artikelnummer: USB-552348
Artikelname: UBE2K cDNA
Artikelnummer: USB-552348
Hersteller Artikelnummer: 552348
Alternativnummer: USB-552348-10
Hersteller: US Biological
Kategorie: Molekularbiologie
UBE2K encoded by this gene belongs to the ubiquitin-conjugating enzyme family. UBE2K interacts with RING finger proteins, and it can ubiquitinate huntingtin, UBE2K product for Huntingtons disease. Known functions for UBE2K include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 603bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAGACGAGCAAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTCCAGACACACCATATGAAGGAGGAAGATACCAACTAGAGATAAAAATACCAGAAACATACCCATTTAATCCCCCTAAGGTCCGGTTTATCACTAAAATATGGCATCCTAATATTAGTTCCGTCACAGGGGCTATTTGTTTGGATATCCTGAAAGATCAATGGGCAGCTGCAATGACTCTCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGA Translation Sequence: MANIAVQRIK REFKEVLKSE ETSKNQIKVD LVDENFTELR GEIAGPPDTP YEGGRYQLEIKIPETYPFNP PKVRFITKIW HPNISSVTGA ICLDILKDQW AAAMTLRTVL LSLQALLAAAEPDDPQDAVV ANQYKQNPEM FKQTARLWAH VYAGAPVSSP EYTKKIENLC AMGFDRNAVIVALSSKSWDV ETATELLLSN Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 005330
Formulierung: Supplied as a lyophilized powder.