TTTY13 siRNA/shRNA/RNAi Lentivector (Human) (Target b) - i026375b

Catalog Number: ABM-487450910595
Article Name: TTTY13 siRNA/shRNA/RNAi Lentivector (Human) (Target b) - i026375b
Biozol Catalog Number: ABM-487450910595
Supplier Catalog Number: 487450910595
Alternative Catalog Number: ABM-487450910595
Manufacturer: Applied Biological Materials
Category: Molekularbiologie
Species Reactivity: Human
Source: Puromycin
Sequence: TACGTCCAAGGTCGGGCAGGAAGA
Target: Sequence available upon placing order