TTTY13 siRNA/shRNA/RNAi Lentivector (Human) (Target c) - i026375c

Catalog Number: ABM-487450910695
Article Name: TTTY13 siRNA/shRNA/RNAi Lentivector (Human) (Target c) - i026375c
Biozol Catalog Number: ABM-487450910695
Supplier Catalog Number: 487450910695
Alternative Catalog Number: ABM-487450910695
Manufacturer: Applied Biological Materials
Category: Molekularbiologie
Species Reactivity: Human
Source: Puromycin
Sequence: TACGTCCAAGGTCGGGCAGGAAGA
Target: Sequence available upon placing order