| The Methylated cytosine DNA standard kit is a set of five DNA standards that are linear dsDNA, 426 bp, and have the same sequence (see sequence below & figure). The only difference is that each contains either normal cytosines, 5-methylcytosines, 5-hydroxymethylcytosines, 5-formylcytosines, or 5-carboxylcytosines. Since the sequence and extent of cytosine modification is known, this DNA standard set is ideal for use in calibration of various applications intended for quantitation of cytosine modifications. Sequence Information: 5CGGGGTACCTTCACTTCAGAATCAACCAAACAGCCAAAACTGTTACATCAGGTTGTGGA GCAGTTACAAAAGGTTCATTTTATCACAGATACCCTGTCAAAGGGTGAGACAAAGTTCATG GGTGTTTGCCAGCTTCCCAGTAAAAATGATGAAAAAGAATATCCACACAGAAGAATTGATA TCAGGTTGATACCCAAAGATCAGTATTACTGTGGTGTTCTCTATTTCACTGGGAGTGATAT TTTCAATAAGAATATGAGGGCTCATGCCCTAGAAAAGGGTTTCACAATCAATGAGTACACC ATCCGTCCCTTGGGAGTCACTGGAGTTGCAGGAGAACCCCTGCCAGTGGATAGTGAAAAA GACATCTTTGATTACATCCAGTGGAAATACCGGGAACCCAAGGACCGGAGCGAAGAATTC CCG 3 Note: Sequence is same for all five standards. Depending on the DNA, all Cs are unmodified cytosine, 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine. |
