Bepirovirsen (sodium), CAS [[2563929-84-8]]

Produktübersicht

• Artikelname: Bepirovirsen (sodium), CAS [[2563929-84-8]]
• Artikelnummer: MCE-HY-147217A
• Hersteller Artikelnummer: HY-147217A
• Alternativnummer: MCE-HY-147217A-5MG,MCE-HY-147217A-1MG,MCE-HY-147217A-10MG
• Hersteller: MedchemExpress
• Kategorie: Biochemikalien
• Alternative Synonym: ISIS 505358 (sodium)

Produktbeschreibung

Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3].

Produkteigenschaften

• Molekulargewicht: 7344 (free acid)
• Reinheit: 98.44
• CAS Nummer: [2563929-84-8]
• Formel: C230H290N88Na19O115P19S19
• Target-Kategorie: HBV

Anwendungsbeschreibung

• Anwendungsbeschreibung: MCE Product type: Oligonucleotides