Bepirovirsen (sodium), CAS [[2563929-84-8]]

Catalog Number: MCE-HY-147217A
Article Name: Bepirovirsen (sodium), CAS [[2563929-84-8]]
Biozol Catalog Number: MCE-HY-147217A
Supplier Catalog Number: HY-147217A
Alternative Catalog Number: MCE-HY-147217A-10MG,MCE-HY-147217A-5MG,MCE-HY-147217A-1MG
Manufacturer: MedchemExpress
Category: Biochemikalien
Alternative Names: ISIS 505358 (sodium)
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3].
Molecular Weight: 7344 (free acid)
Purity: 98.44
CAS Number: [2563929-84-8]
Formula: C230H290N88Na19O115P19S19
Target: HBV
Application Notes: MCE Product type: Oligonucleotides