Bepirovirsen (sodium), CAS [[2563929-84-8]]

Product Overview

• Article Name: Bepirovirsen (sodium), CAS [[2563929-84-8]]
• Biozol Catalog Number: MCE-HY-147217A
• Supplier Catalog Number: HY-147217A
• Alternative Catalog Number: MCE-HY-147217A-5MG,MCE-HY-147217A-1MG,MCE-HY-147217A-10MG
• Manufacturer: MedchemExpress
• Category: Biochemikalien
• Alternative Names: ISIS 505358 (sodium)

Product Description

Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3].

Product Properties

• Molecular Weight: 7344 (free acid)
• Purity: 98.44
• CAS Number: [2563929-84-8]
• Formula: C230H290N88Na19O115P19S19
• Target: HBV

Application Notes

• Application Notes: MCE Product type: Oligonucleotides