CD158a Recombinant Protein, E. coli

Catalog Number: BWT-NCP0282
Article Name: CD158a Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0282
Supplier Catalog Number: NCP0282
Alternative Catalog Number: BWT-NCP0282-500UG,BWT-NCP0282-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
NKAT (NK-associated transcripts) gene products, known as killer immunoglobulin-like receptors or KIRs, downregulate the cytotoxicity of NK cells upon recognition of specific class I major histocompatibility complex (MHC) molecules on target cells. This family of receptors is characterized by an extracellular region with two to three immunoglobulin-superfamily domains and a cytoplasmic domain with an antigen receptor activation motif (ARAM). KIRs and other inhibitory receptors also possess a common cytoplasmic sequence (I/VxYxxL/V) known as an ITIM (immunoreceptor tyrosine-based inhibitory motif). The human inhibitory natural killer cell immunoglobulin-like receptor 2DL1, also designated KIR2DL1, CL-42, NKAT1, P58.1 or CD158a long form, is a 348 amino acid type I transmembrane protein. KIR2DL1 can bind human leukocyte antigen-C (HLA-C) via both polar and hydrophobic interactions through Met 44 in a binding pocket that coordinates Lys 80 of HLA-C.
Molecular Weight: ~30kDa
Tag: His-tag
UniProt: P43626
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: CATGAAGGTGTGCATCGTAAACCGAGTCTGCTGGCCCATCCGGGTCCGCTGGTGAAAAGCGAAGAAACCGTGATTCTGCAGTGCTGGAGCGATGTTATGTTCGAACACTTCCTGCTGCATCGCGAAGGCATGTTCAATGATACCCTGCGCCTGATTGGTGAACATCATGATGGTGTTAGCAAAGCAAACTTCAGTATTAGCCGTATGACCCAGGATCTGGCCGGTACCTATCGTTGCTATGGCAGCGTTACCCAT