CD158b2 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0283
Article Name: CD158b2 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0283
Supplier Catalog Number: NCP0283
Alternative Catalog Number: BWT-NCP0283-500UG,BWT-NCP0283-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
Killer cell immunoglobulin-like receptors (KIRs) are type 1 transmembrane glycoproteins expressed by natural killer cells and subsets of CD4, CD8, and gammadelta T cells. Analogous to the diversity of their human leucocyte antigen class I (HLA Class I) ligands, the KIR genes are polymorphic and the content of the KIR gene cluster varies among haplotypes, although several framework genes are found in all haplotypes. The KIR proteins are characterized by the number of extracellular immunoglobulin-superfamily domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack an ITIM and instead transduce activating signals. KIR proteins play an important role in the regulation of the immune response. Combinations of KIR and HLA class I variants influence susceptibility to autoimmunity and infectious disease, as well as outcomes of haematopoietic stem cell transplantation.
Molecular Weight: ~30kDa
Tag: His-tag
UniProt: P43628
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: CATGAAGGCGTTCATCGCAAACCGAGTCTGCTGGCACATCCGGGTCCGCTGGTTAAAAGCGAAGAAACCGTGATTCTGCAGTGCTGGAGTGATGTTCGCTTCCAGCACTTCCTGCTGCATCGCGAAGGCAAATTCAAAGATACCCTGCATCTGATTGGCGAACATCATGATGGTGTTAGCAAAGCCAACTTCAGCATTGGTCCGATGATGCAGGATCTGGCCGGTACCTATCGCTGCTATGGCAGTGTGACCCAT