CD163 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0287
Article Name: CD163 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0287
Supplier Catalog Number: NCP0287
Alternative Catalog Number: BWT-NCP0287-500UG,BWT-NCP0287-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
CD163 is a transmembrane scavenger receptor expressed on the macrophage surface. It has 9 B-type SRCR extracellular domains mediating serum haptoglobin clearing/endocytosis, pathogen binding and signal transduction, and calcium binding. CD163 is used as a surface marker of M2 type macrophages, including M2 type tumor associated macrophages (TAMs), which facilitate cancer progression by secreting cytokines to promote angiogenesis, immunosuppression and metastasis. Inflammatory stimulation and stress signal can induce extracellular domain shedding of CD163 to generate soluble CD163 (sCD163). The increased sCD163 level in serum is associated with low-grade inflammation in disease conditions.
Molecular Weight: ~89kDa
Tag: His-tag
UniProt: Q86VB7
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: AGCAGCCTGGGCGGTACCGATAAAGAACTGCGTCTGGTGGATGGTGAAAATAAATGCAGTGGTCGTGTGGAAGTGAAAGTTCAGGAAGAATGGGGCACCGTGTGTAATAATGGTTGGAGCATGGAAGCCGTTAGCGTGATCTGTAATCAGCTGGGCTGCCCGACCGCAATTAAAGCCCCGGGCTGGGCCAATAGTAGTGCAGGCAGTGGCCGTATCTGGATGGATCATGTTAGCTGCCGTGGCAATGAAAGCGCC