CD164 Recombinant Protein, E. coli

Product Overview

• Article Name: CD164 Recombinant Protein, E. coli
• Biozol Catalog Number: BWT-NCP0288
• Supplier Catalog Number: NCP0288
• Alternative Catalog Number: BWT-NCP0288-500UG,BWT-NCP0288-1MG
• Manufacturer: Bioworld Technology
• Host: E. coli
• Category: Proteine/Peptide

Product Description

CD164 is a mucin-like cell surface glycoprotein that facilitates adhesion of CD34+ cells and serves as a negative regulator of hematopoietic progenitor cell proliferation. Human CD164 in CD34+CD38+ hematopoietic progenitor and epithelial cell lines localizes to endosomes and lysosomes, with low concentrations also appearing at the cell surface.

Product Properties

• Molecular Weight: ~24kDa
• Tag: His-tag
• UniProt: Q04900
• Buffer: PBS, 4M Urea, PH7.4
• Expression System: pet-22b(+)
• Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
• Sequence: GATAAGAACACCACCCAGCATCCGAATGTGACCACCCTGGCACCGATTAGTAATGTTACCAGTGCACCGGTGACCAGTCTGCCGCTGGTTACCACCCCGGCACCGGAAACCTGTGAAGGTCGTAATAGTTGTGTTAGCTGCTTCAATGTGAGCGTGGTGAATACCACCTGCTTCTGGATTGAATGCAAAGATGAAAGCTATTGTAGCCATAATAGCACCGTTAGCGATTGCCAGGTGGGCAATACCACCGACTTC