CD167a Recombinant Protein, E. coli

Catalog Number: BWT-NCP0289
Article Name: CD167a Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0289
Supplier Catalog Number: NCP0289
Alternative Catalog Number: BWT-NCP0289-500UG,BWT-NCP0289-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
The discoidin domain receptors (DDRs) are receptor tyrosine kinases with a discoidin homology repeat in their extracellular domains, activated by binding to extracellular matrix collagens. So far, two mammalian DDRs have been identified: DDR1 and DDR2. They are widely expressed in human tissues and may have roles in smooth muscle cell-mediated collagen remodeling. Research studies have implicated aberrant expression and signaling of DDRs in human diseases related to increased matrix degradation and remodeling, such as cardiovascular disease, liver fibrosis, and tumor invasion.
Molecular Weight: ~44kDa
Tag: His-tag
UniProt: Q08345
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: GATATGAAGGGTCACTTCGATCCGGCCAAATGCCGCTATGCACTGGGTATGCAGGATCGTACCATTCCGGATAGTGATATTAGCGCAAGTAGCAGCTGGAGTGATAGCACCGCAGCACGTCATAGTCGTCTGGAAAGTAGCGATGGCGATGGTGCCTGGTGCCCGGCCGGTTCAGTGTTCCCGAAAGAAGAAGAATATCTGCAGGTTGATCTGCAGCGTCTGCATCTGGTGGCACTGGTTGGTACCCAGGGCCGT