CD169 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0291
Article Name: CD169 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0291
Supplier Catalog Number: NCP0291
Alternative Catalog Number: BWT-NCP0291-500UG,BWT-NCP0291-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
Chromogranins (secretogranins) are acidic glycoproteins that localize within secretory granules of endocrine, neuroendocrine and neuronal tissue. Family members include chromogranin A (Chr-A), chromogranin B (Chr-B), also known as secretogranin I, chromogranin C (also known as secretogranin II or Sg II), and secretogranin III (Sg III or SCG3). High levels of Chr-A expression are characteristic of neuroendocrine tumors. Pancreastatin is a peptide derived from Chr-A which inhibits Insulin secretion, exocrine pancreatic secretion and gastric acid secretion. Pancreastatin exists as two forms, the major form is expressed in stomach and colon extracts. In neuroendocrine cells the level Sg II has been shown to increase four-fold in response to histamine, while levels of Chr-A and Chr-B showed little or no increase. Sg III is an acidic secretory protein expressed in neuronal and endocrine cells. In the anterior lobe of the rat pituitary gland, Sg III is present in mammotropes and thyrotropes, moderately in gonadotropes and corticotropes, though not in somatotropes. Sg III and carboxypeptidase E (CPE) bind specifically to cholesterolrich secretory granule (SG) membranes.
Molecular Weight: ~86kDa
Tag: His-tag
UniProt: Q9BZZ2
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: AGCTGGGGTGTGAGCAGCCCGCAGGATGTGCAGGGCGTTAAAGGTAGTTGCCTGCTGATTCCGTGTATCTTCAGCTTCCCGGCAGATGTTGAAGTGCCGGATGGTATTACCGCAATCTGGTATTATGATTATAGCGGTCAGCGTCAGGTGGTGAGCCATAGCGCCGATCCGAAACTGGTGGAAGCCCGCTTCCGCGGCCGCACAGAATTCATGGGTAATCCGGAACATCGTGTGTGCAATCTGCTGCTGAAAGAT