CD170 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0292
Article Name: CD170 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0292
Supplier Catalog Number: NCP0292
Alternative Catalog Number: BWT-NCP0292-500UG,BWT-NCP0292-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
Two families of mammalian lectin-like adhesion molecules bind glycoconjugate ligands in a sialic acid-dependent manner: the selectins and the sialoadhesins. The sialic acid-binding immunoglobulin superfamily lectins, designated siglecs or sialoadhesins, are immunoglobulin superfamily members recognizing sialylated ligands. Siglec-5 binds equally to alpha2,3-linked and alpha2,6-linked sialic acid. There exist four isoforms of hSiglec-5 possessing three (hSiglec-5-3L and -3C) or four (hSiglec-5-4L and -4S) extracellular domains linked to long (hSiglec-5-3L and -4L) or short (hSiglec-5-4S) cytoplasmic tails or existing as a soluble isoform (hSiglec-5-3C). Siglec-5 is expressed by monocytes and neutrophils, but is absent from leukemic cell lines representing early stages of myelomonocytic differentiation. Siglec-5 may play a role in the diagnosis and monitoring of acute myeloid leukemia (AML).
Molecular Weight: ~47kDa
Tag: His-tag
UniProt: O15389
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: GAAAAGCCGGTGTATGAACTGCAGGTTCAGAAAAGCGTGACCGTGCAGGAAGGCCTGTGTGTGCTGGTGCCGTGTAGCTTCAGCTATCCGTGGCGCAGCTGGTATAGTAGTCCGCCGCTGTATGTGTATTGGTTCCGCGATGGTGAAATTCCGTATTATGCCGAAGTTGTTGCCACCAATAATCCGGATCGCCGTGTTAAACCGGAAACACAAGGTCGCTTCCGCCTGCTGGGTGATGTGCAGAAAAAAAATTGT