CD336 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0296
Article Name: CD336 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0296
Supplier Catalog Number: NCP0296
Alternative Catalog Number: BWT-NCP0296-500UG,BWT-NCP0296-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
Natural killer (NK) cells direct cytotoxicity against tumor or virally infected cells. NK cell-mediated cytotoxicity is stimulated by several activating receptors associated with the signaling adapter DNAX activation 12/killer cellactivating receptor-associated protein (DAP12). NKp44 is a natural cytotoxicity receptor that is expressed on IL-2-activated human NK cells and may contribute to the increased efficiency of NK cells to mediate tumor cell lysis. NKp44 is composed of one Ig-like extracellular domain, a transmembrane segment and a cytoplasmic domain. Prolactin upregulates and cortisol downregulates the surface expression of NKp44 at the transcriptional level. A cellular ligand for NKp44 (NKp44L) is expressed during HIV-1 infection and is correlated with the progression of CD4+ T cell depletion and an increase of viral load. This implicates NKp44 as a therapeutic agent that may aid in the progress towards a vaccine for HIV-1 infection.
Molecular Weight: ~19kDa
Tag: His-tag
UniProt: O95944
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: CAGAGTAAAGCCCAGGTTCTGCAGAGCGTGGCCGGTCAGACCCTGACCGTGCGTTGTCAGTATCCGCCGACCGGCAGCCTGTATGAAAAAAAAGGTTGGTGTAAAGAAGCAAGTGCACTGGTGTGTATTCGTCTGGTGACCAGCAGTAAACCGCGTACCATGGCATGGACCAGTCGCTTCACCATCTGGGATGATCCGGATGCCGGCTTCTTCACCGTTACCATGACCGATCTGCGCGAAGAAGATAGTGGCCAT