CD338 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0298
Article Name: CD338 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0298
Supplier Catalog Number: NCP0298
Alternative Catalog Number: BWT-NCP0298-500UG,BWT-NCP0298-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
ABCG2 (BCRP1/ABCP/MXR) is a member of the ATP-binding cassette transporter family that functions as ATP-dependent transporters for a wide variety of chemical compounds and are associated with drug-resistance in cancer cells. ABCG2 is a heavily glycosylated transmembrane protein with six transmembrane spanning regions consistent with it functioning as a half-transporter. The ABC family can exist as either full-length transporters or as half-transporters that form functional transporters through homo- or heterodimerization. High expression of ABCG2 was found in placenta as well as cell lines selected for resistance to a number of chemotherapeutic drugs, including mitoxantrone, doxorubicin, topotecan and flavopiridol. In rodents, the highest expression of ABCG2 was found in kidney. ABCG2 expression has also been observed in stem cell populations, particularly in hematopoietic and neuronal stem cells and is downregulated with differentiation.
Molecular Weight: ~43kDa
Tag: His-tag
UniProt: Q9UNQ0
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: AGCAGTAGCAATGTGGAAGTGTTCATTCCGGTGAGCCAGGGTAATACCAATGGCTTCCCGGCAACCGCAAGCAATGATCTGAAAGCCTTCACCGAAGGCGCAGTGCTGAGCTTCCATAATATCTGTTATCGCGTTAAACTGAAAAGTGGCTTCCTGCCGTGTCGTAAACCGGTGGAAAAAGAAATTCTGAGTAATATTAACGGCATCATGAAACCGGGCCTGAATGCAATTCTGGGTCCGACCGGCGGCGGTAAA