CD349 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0300
Article Name: CD349 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0300
Supplier Catalog Number: NCP0300
Alternative Catalog Number: BWT-NCP0300-500UG,BWT-NCP0300-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
Receptor for WNT2 that is coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. Plays a role in neuromuscular junction (NMJ) assembly by negatively regulating the clustering of acetylcholine receptors (AChR) through the beta-catenin canonical signaling pathway. May play a role in neural progenitor cells (NPCs) viability through the beta-catenin canonical signaling pathway by negatively regulating cell cycle arrest leading to inhibition of neuron apoptotic process. During hippocampal development, regulates neuroblast proliferation and apoptotic cell death. Controls bone formation through non canonical Wnt signaling mediated via ISG15. Positively regulates bone regeneration through non canonical Wnt signaling (By similarity).
Molecular Weight: ~28kDa
Tag: His-tag
UniProt: O00144
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: CTGGAAATTGGTCGCTTCGATCCGGAACGTGGCCGTGGTGCCGCCCCTTGTCAGGCAGTTGAAATTCCGATGTGCCGTGGTATTGGTTATAATCTGACCCGCATGCCGAATCTGCTGGGCCATACCAGTCAGGGCGAAGCAGCCGCCGAACTGGCAGAATTCGCCCCGCTGGTTCAGTATGGTTGCCATAGCCATCTGCGCTTCTTCCTGTGTAGCCTGTATGCCCCGATGTGCACCGATCAGGTTAGCACCCCG