CD352 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0302
Article Name: CD352 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0302
Supplier Catalog Number: NCP0302
Alternative Catalog Number: BWT-NCP0302-500UG,BWT-NCP0302-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
SLAMF6 (CD352/NTB-A) is a type-I transmembrane glycoprotein belonging to the signaling lymphocytic activation molecule (SLAM) family of immunomodulatory receptors. Like other members of the SLAM receptor family, SLAMF6 contains Ig-like domains within its extracellular region and conserved tyrosine-based signaling motifs within its intracellular domain that, when phosphorylated, bind to the SAP and EAT-2 signaling adaptors. SLAMF6 is expressed on the surface of multiple types of immune cells, such as those of the B, T, and NK lineages. Its activation is triggered by homotypic interactions involving its extracellular domain. Indeed, research studies have shown that in T-cells, SLAMF6 engagement facilitates activation and cytokine production. Similarly, homotypic ligand-mediated engagement of SLAMF6 on NK cells activates signaling cascades that drive proliferation, cytotoxicity, and cytokine production.
Molecular Weight: ~25kDa
Tag: His-tag
UniProt: Q96DU3
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: CAGAGTAGTCTGACCCCGCTGATGGTTAATGGTATTCTGGGCGAAAGTGTTACCCTGCCGCTGGAATTCCCGGCAGGCGAAAAAGTTAACTTCATTACCTGGCTGTTCAATGAAACCAGTCTGGCATTCATTGTTCCGCATGAAACCAAAAGTCCGGAAATTCATGTTACCAATCCGAAACAGGGCAAACGCCTGAACTTCACCCAGAGTTATAGCCTGCAGCTGAGTAATCTGAAAATGGAAGATACCGGTAGT