CD354 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0304
Article Name: CD354 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0304
Supplier Catalog Number: NCP0304
Alternative Catalog Number: BWT-NCP0304-500UG,BWT-NCP0304-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
TREM-1 (triggering receptor expressed on myeloid cells-1) is expressed in monocytes and neutrophils but not in lymphocytes, dendritic cells, or other cell types. TREM-1 is a glycoprotein that is reduced by deglycosylation, in agreement with the predicted molecular mass. TREM-1 is an activating receptor of the Ig superfamily that is expressed on human myeloid cells, selectively expressed on blood neutrophils and a subset of monocytes, and is upregulated by bacterial LPS. Immunoblot analysis shows that TREM-1 is associated with DAP12, a molecule frequently associated with activating receptors. TREM-1 and the myeloid DAP12-associating lectin (MDL-1) are recently identified receptors which associate non-covalently with DAP12 to form receptor complexes that are involved in monocytic activation and inflammatory response.
Molecular Weight: ~24kDa
Tag: His-tag
UniProt: Q9NP99
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: GCAACCAAACTGACCGAAGAAAAATATGAACTGAAAGAAGGTCAGACCCTGGATGTGAAATGCGATTATACCCTGGAAAAATTCGCAAGTAGCCAGAAAGCATGGCAGATTATTCGTGATGGCGAAATGCCGAAAACCTTAGCCTGTACCGAACGTCCGAGCAAAAATAGTCATCCGGTTCAGGTTGGCCGCATTATTCTGGAAGATTATCATGATCATGGTCTGCTGCGCGTGCGTATGGTTAATCTGCAGGTG