CD358 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0307
Article Name: CD358 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0307
Supplier Catalog Number: NCP0307
Alternative Catalog Number: BWT-NCP0307-500UG,BWT-NCP0307-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regulation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL). They are characterized by a highly conserved extracellular region containing cysteine-rich repeats and a conserved intracellular region of about 80 amino acids termed the death domain (DD). The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resulting in activation of caspases. DR6, also known as TNFRSF21, is a TNFR family member able to induce apoptosis as well as activation of NF-kappaB and JNK. Expression of DR6 is upregulated by NF-kappaB signaling. DR6 appears to play a critical role in the activation and differentiation of T and B lymphocytes. In the nervous system, beta-amyloid precursor protein (APP) activates DR6 to trigger neuronal degeneration.
Molecular Weight: ~35kDa
Tag: His-tag
UniProt: O75509
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: CAGCCTGAACAGAAAGCCAGTAATCTGATTGGTACCTATCGCCATGTTGATCGCGCCACCGGTCAGGTGCTGACCTGCGATAAATGTCCGGCAGGCACCTATGTTAGCGAACATTGTACCAATACCAGTCTGCGCGTGTGCAGTAGCTGTCCGGTTGGTACCTTCACCCGTCATGAAAATGGCATTGAAAAATGCCATGATTGTAGTCAGCCGTGTCCGTGGCCGATGATTGAAAAACTGCCGTGCGCCGCCCTG