CD361 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0309
Article Name: CD361 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0309
Supplier Catalog Number: NCP0309
Alternative Catalog Number: BWT-NCP0309-500UG,BWT-NCP0309-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
EVI2B, required for granulocyte differentiation and functionality of hematopoietic progenitor cells through the control of cell cycle progression and survival of hematopoietic progenitor cells.
Molecular Weight: ~25kDa
Tag: His-tag
UniProt: P34910
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: AAGACCGAAACCATTACCACCGAAAAACAGAGCCAGCCGACCCTGTTCACCAGTAGTATGAGTCAGGTGCTGGCCAATAGTCAGAATACCACCGGTAATCCGCTGGGCCAGCCGACCCAGTTCAGTGATACCTTCAGTGGCCAGAGTATTAGCCCGGCAAAAGTTACCGCAGGTCAGCCGACCCCGGCCGTGTATACCAGCAGTGAAAAACCGGAAGCCCATACCAGTGCCGGTCAGCCGCTGGCATATAATACC