CD362 Recombinant Protein, E. coli

Catalog Number: BWT-NCP0310
Article Name: CD362 Recombinant Protein, E. coli
Biozol Catalog Number: BWT-NCP0310
Supplier Catalog Number: NCP0310
Alternative Catalog Number: BWT-NCP0310-500UG,BWT-NCP0310-1MG
Manufacturer: Bioworld Technology
Host: E. coli
Category: Proteine/Peptide
Syndecans are type I integral membrane proteoglycans that contain both chondroitin sulfate and heparan sulfate groups. Syndecans are involved in cell-extracellular matrix adhesion and growth factor binding. Syndecan-1 (SYND1, also called CD138) is anextracellular matrix receptor which binds to collagens, Fibronectin and Thrombospondin. Syndecan-1 and Syndecan-3 (also designated N-Syndecan) interact with MK (midkine), a growth/differentiation factor invloved in embryogenesis of the central nervous system. Syndecan-2 (also designated fibroglycan or HSPG) is highly expressed at areas of high morphogenetic activity, such as epithelial-mesenchymal interfaces and the prechondrogenic and preosteogenic mesenchymal condensations. Syndecan-4 (also designated amphiglycan or ryudocan) functions cooperativley with integrins in the processes of cell spreading, focal adhesion assembly and Actin stress fiber assembly
Molecular Weight: ~27kDa
Tag: His-tag
UniProt: P34741
Buffer: PBS, 4M Urea, PH7.4
Expression System: pet-22b(+)
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: GAAAGCCGCGCCGAACTGACCAGCGATAAAGATATGTATCTGGATAATAGCAGCATTGAAGAAGCAAGCGGTGTGTATCCGATTGATGATGATGATTATGCAAGTGCCAGCGGTAGCGGTGCAGATGAAGATGTGGAAAGCCCGGAACTGACCACCAGTCGTCCGCTGCCGAAAATTCTGCTGACCAGCGCCGCCCCGAAAGTTGAAACCACCACCCTGAATATTCAGAATAAAATTCCGGCCCAGACCAAAAGT