ABT1
Catalog Number:
BYT-ORB595236
| Article Name: |
ABT1 |
| Biozol Catalog Number: |
BYT-ORB595236 |
| Supplier Catalog Number: |
orb595236 |
| Alternative Catalog Number: |
BYT-ORB595236-10 |
| Manufacturer: |
Biorbyt |
| Category: |
Proteine/Peptide |
| Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| NCBI: |
29777 |
| UniProt: |
BC048812 |
| Sequence: |
atggaggcagaggaatcggagaaggccgcaacggagcaagagccgctggaagggacagaacagacactagatgcggaggaggagcaggaggaatccgaagaagcggcctgtggcagcaagaagcgggtagtgccaggtattgtgtacctgggccatatcccgccgcgcttccggcccctgcacgtccgcaaccttctcagcgcctatggcgaggtcggacgcgtcttctttcaggctgaggaccggttcgtgag |
| Application Notes: |
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
