Bepirovirsen, CAS [[1403787-62-1]]

Product Overview

• Article Name: Bepirovirsen, CAS [[1403787-62-1]]
• Biozol Catalog Number: MCE-HY-147217
• Supplier Catalog Number: HY-147217
• Alternative Catalog Number: MCE-HY-147217-5MG,MCE-HY-147217-1MG
• Manufacturer: MedchemExpress
• Category: Biochemikalien
• Alternative Names: ISIS 505358

Product Description

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

Product Properties

• Molecular Weight: 7344.00
• Purity: 98.44
• CAS Number: [1403787-62-1]
• Formula: C230H309N88O115P19S19
• Target: HBV

Application Notes

• Application Notes: MCE Product type: Oligonucleotides