Bepirovirsen, CAS [[1403787-62-1]]

Catalog Number: MCE-HY-147217
Article Name: Bepirovirsen, CAS [[1403787-62-1]]
Biozol Catalog Number: MCE-HY-147217
Supplier Catalog Number: HY-147217
Alternative Catalog Number: MCE-HY-147217-1MG,MCE-HY-147217-5MG
Manufacturer: MedchemExpress
Category: Biochemikalien
Alternative Names: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
Molecular Weight: 7344.00
Purity: 98.44
CAS Number: [1403787-62-1]
Formula: C230H309N88O115P19S19
Target: HBV
Application Notes: MCE Product type: Oligonucleotides