Bepirovirsen, CAS [[1403787-62-1]]

Catalog Number: TGM-T74569
Article Name: Bepirovirsen, CAS [[1403787-62-1]]
Biozol Catalog Number: TGM-T74569
Supplier Catalog Number: T74569
Alternative Catalog Number: TGM-T74569-1MG,TGM-T74569-5MG
Manufacturer: TargetMol
Category: Biochemikalien
Bepirovirsen, an antisense oligonucleotide, targets all HBV messenger RNAs, resulting in decreased levels of HBV-derived RNAs, HBV DNA, and viral proteins. It is utilized in researching chronic HBV infection. The binding site sequence of Bepirovirsen is (GCACTTCGCTTCACCTCTGC) [1].
Molecular Weight: 7344
CAS Number: [1403787-62-1]
Target: Others|||HBV