ABRACL cDNA

Catalog Number: USB-551817
Article Name: ABRACL cDNA
Biozol Catalog Number: USB-551817
Supplier Catalog Number: 551817
Alternative Catalog Number: USB-551817-10
Manufacturer: US Biological
Category: Molekularbiologie
ABRACL (ABRA C-Terminal Like) belongs to a new family of low molecular weight proteins, which is only present in eukaryotes, and is absent in fungi. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 246bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAATGTGGATCACGAGGTTAACCTCTTAGTGGAGGAAATTCATCGTTTGGGTTCAAAAAATGCTGATGGAAAGTTAAGCGTGAAATTTGGGGTCCTCTTCCGTGATGATAAATGTGCCAACCTCTTTGAAGCATTGGTAGGAACTCTTAAAGCTGCAAAACGAAGGAAGATTGTAACATATCCAGGAGAGCTGCTTCTGCAAGGTGTTCATGATGATGTTGACATTATATTACTGCAAGATTAA Translation Sequence: MNVDHEVNLL VEEIHRLGSK NADGKLSVKF GVLFRDDKCA NLFEALVGTL KAAKRRKIVT YPGELLLQGV HDDVDIILLQ D Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 067066
Form: Supplied as a lyophilized powder.