ARF4 cDNA

Catalog Number: USB-551838
Article Name: ARF4 cDNA
Biozol Catalog Number: USB-551838
Supplier Catalog Number: 551838
Alternative Catalog Number: USB-551838-10
Manufacturer: US Biological
Category: Molekularbiologie
ARF4 is a member of the human ARF gene family whose members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 5 ARF proteins and 11 ARF-like proteins and constitute one family of the RAS superfamily. The ARF proteins are categorized as class I, class II and class III, this gene is a class II member. The members of each class share a common gene organization. The ARF4 gene spans approximately 12kb and contains six exons and five introns. This gene is the most divergent member of the human ARFs. Conflicting map positions at 3p14 or 3p21 have been reported for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 543bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGCCTCACTATCTCCTCCCTCTTCTCCCGACTATTTGGCAAGAAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTCTGTATAAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGGTCAAGATAGAATTAGGCCTCTCTGGAAGCATTACTTCCAGAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAACGATCGTGAAAGAATTCAGGAAGTAGCAGATGAGCTGCAGAAAATGCTTCTGGTAGATGAATTGAGAGATGCAGTGCTGCTACTTTTTGCAAACAAACAGGATTTGCCAAATGCTATGGCCATCAGTGAAATGACAGATAAACTAGGGCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCAACACAAGGAACTGGTCTGTATGAAGGACTTGACTGGCTGTCAAATGAGCTTTCAAAACGTTAA Translation Sequence: MGLTISSLFS RLFGKKQMRI LMVGLDAAGK TTILYKLKLG EIVTTIPTIG FNVETVEYKN ICFTVWDVGG QDRIRPLWKH YFQNTQGLIF VVDSNDRERI QEVADELQKM LLVDELRDAV LLLFANKQDL PNAMAISEMT DKLGLQSLRN RTWYVQATCA TQGTGLYEGL DWLSNELSKR Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001651
Form: Supplied as a lyophilized powder.