ARL1 cDNA

Catalog Number: USB-551841
Article Name: ARL1 cDNA
Biozol Catalog Number: USB-551841
Supplier Catalog Number: 551841
Alternative Catalog Number: USB-551841-10
Manufacturer: US Biological
Category: Molekularbiologie
ARL encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). ARFs, described as activators of cholera toxin (CT) ADP-ribosyltransferase activity, regulate intracellular vesicular membrane trafficking, and stimulate a phospholipase D (PLD) isoform. Although, ARL proteins were initially thought not to activate CT or PLD, later work showed that they are weak stimulators of PLD and CT in a phospholipid dependent manner. Alternative splicing results in multiple transcript variants encoding different isoforms. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 546bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGTGGCTTTTTCTCAAGTATATTTTCCAGTCTGTTTGGAACTCGGGAAATGAGAATTTTAATTTTGGGATTAGATGGAGCAGGAAAAACCACAATTTTGTACAGATTACAAGTGGGAGAAGTTGTTACTACTATACCTACCATTGGATTTAATGTAGAGACGGTGACGTACAAAAACCTTAAATTCCAAGTCTGGGATTTAGGAGGACAGACAAGTATCAGGCCATACTGGAGATGTTACTATTCAAACACAGATGCAGTCATTTATGTAGTAGACAGTTGTGACCGAGACCGAATTGGCATTTCCAAATCAGAGTTAGTTGCCATGTTGGAGGAAGAAGAGCTGAGAAAAGCCATTTTAGTGGTGTTTGCAAATAAACAGGACATGGAACAGGCCATGACTTCCTCAGAGATGGCAAATTCACTTGGGTTACCTGCCTTGAAGGACCGAAAATGGCAGATATTCAAAACGTCAGCAACCAAAGGCACCGGCCTTGATGAGGCAATGGAATGGTTAGTTGAAACATTAAAAAGCAGACAGTAA Translation Sequence: MGGFFSSIFS SLFGTREMRI LILGLDGAGK TTILYRLQVG EVVTTIPTIG FNVETVTYKN LKFQVWDLGG QTSIRPYWRC YYSNTDAVIY VVDSCDRDRI GISKSELVAM LEEEELRKAI LVVFANKQDM EQAMTSSEMA NSLGLPALKD RKWQIFKTSA TKGTGLDEAM EWLVETLKSR Q Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001168
Form: Supplied as a lyophilized powder.