ARL3 cDNA

Catalog Number: USB-551844
Article Name: ARL3 cDNA
Biozol Catalog Number: USB-551844
Supplier Catalog Number: 551844
Alternative Catalog Number: USB-551844-10
Manufacturer: US Biological
Category: Molekularbiologie
Small GTP-binding protein which cycles between an inactive GDP-bound and an active GTP-bound form, and the rate of cycling is regulated by guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP). Required for normal cytokinesis and cilia signaling. Requires assistance from GTPase-activating proteins (GAPs) like RP2 and PDE6D, in order to cycle between inactive GDP-bound and active GTP-bound forms. Required for targeting proteins such as NPHP3 to the ciliary membrane by releasing myristoylated NPHP3 from UNC119B cargo adapter into the cilium. Does not act as an allosteric activator of the cholera toxin catalytic subunit. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 555bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGCTTGCTCTCAATTTTGCGCAAGTTGAAAAGTGCACCAGACCAGGAGGTGAGAATACTTCTCCTGGGCTTGGATAATGCTGGCAAGACCACTCTTCTGAAGCAGCTTGCATCTGAAGACATCAGCCACATCACACCTACACAGGGTTTCAACATCAAAAGTGTACAATCACAAGGTTTTAAACTGAATGTATGGGACATTGGTGGACAGAGGAAAATCAGACCATACTGGAAGAATTATTTTGAAAATACCGATATTCTTATATATGTAATCGACAGTGCAGACAGAAAAAGATTTGAAGAGACGGGTCAGGAACTAGCGGAATTACTGGAGGAAGAAAAACTAAGTTGTGTGCCAGTGCTCATCTTTGCTAATAAGCAGGATTTGCTCACAGCAGCCCCTGCCTCTGAAATTGCAGAAGGACTGAACCTGCATACCATCCGCGACCGAGTCTGGCAGATCCAGTCTTGCTCAGCTCTCACAGGAGAGGGCGTTCAGGATGGCATGAACTGGGTCTGCAAAAATGTCAATGCAAAGAAGAAATAA Translation Sequence: MGLLSILRKL KSAPDQEVRI LLLGLDNAGK TTLLKQLASE DISHITPTQG FNIKSVQSQGFKLNVWDIGG QRKIRPYWKN YFENTDILIY VIDSADRKRF EETGQELAEL LEEEKLSCVPVLIFANKQDL LTAAPASEIA EGLNLHTIRD RVWQIQSCSA LTGEGVQDGM NWVCKNVNAKKK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 004302
Form: Supplied as a lyophilized powder.