CDK1 cDNA

Catalog Number: USB-551873
Article Name: CDK1 cDNA
Biozol Catalog Number: USB-551873
Supplier Catalog Number: 551873
Alternative Catalog Number: USB-551873-10
Manufacturer: US Biological
Category: Molekularbiologie
The protein encoded by CDK1 is a member of the Ser/Thr protein kinase family. This protein is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with this protein and function as regulatory subunits. The kinase activity of this protein is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of this protein also play important regulatory roles in cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 894bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGAAGATTATACCAAAATAGAGAAAATTGGAGAAGGTACCTATGGAGTTGTGTATAAGGGTAGACACAAAACTACAGGTCAAGTGGTAGCCATGAAAAAAATCAGACTAGAAAGTGAAGAGGAAGGGGTTCCTAGTACTGCAATTCGGGAAATTTCTCTATTAAAGGAACTTCGTCATCCAAATATAGTCAGTCTTCAGGATGTGCTTATGCAGGATTCCAGGTTATATCTCATCTTTGAGTTTCTTTCCATGGATCTGAAGAAATACTTGGATTCTATCCCTCCTGGTCAGTACATGGATTCTTCACTTGTTAAGAGTTATTTATACCAAATCCTACAGGGGATTGTGTTTTGTCACTCTAGAAGAGTTCTTCACAGAGACTTAAAACCTCAAAATCTCTTGATTGATGACAAAGGAACAATTAAACTGGCTGATTTTGGCCTTGCCAGAGCTTTTGGAATACCTATCAGAGTATATACACATGAGGTAGTAACACTCTGGTACAGATCTCCAGAAGTATTGCTGGGGTCAGCTCGTTACTCAACTCCAGTTGACATTTGGAGTATAGGCACCATATTTGCTGAACTAGCAACTAAGAAACCACTTTTCCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGGCACTGAATCATCCATATTTTAATGATTTGGACAATCAGATTAAGAAGATGTAG Translation Sequence: MEDYTKIEKI GEGTYGVVYK GRHKTTGQVV AMKKIRLESE EEGVPSTAIR EISLLKELRH PNIVSLQDVL MQDSRLYLIF EFLSMDLKKY LDSIPPGQYM DSSLVKSYLY QILQGIVFCH SRRVLHRDLK PQNLLIDDKG TIKLADFGLA RAFGIPIRVY THEVVTLWYR SPEVLLGSAR YSTPVDIWSI GTIFAELATK KPLFHGDSEI DQLFRIFRAL GTPNNEVWPE VESLQDYKNT FPKWKPGSLA SHVKNLDENG LDLLSKMLIY DPAKRISGKM ALNHPYFNDL DNQIKKM Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001777
Form: Supplied as a lyophilized powder.