CDKN3 cDNA

Catalog Number: USB-551875
Article Name: CDKN3 cDNA
Biozol Catalog Number: USB-551875
Supplier Catalog Number: 551875
Alternative Catalog Number: USB-551875-10
Manufacturer: US Biological
Category: Molekularbiologie
CDKN3 encoded by this gene belongs to the dual specificity protein phosphatase family. CDKN3 was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. CDKN3 was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for CDKN3. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 639bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAAGCCGCCCAGTTCAATACAAACAAGTGAGTTTGACTCATCAGATGAAGAGCCTATTGAAGATGAACAGACTCCAATTCATATATCATGGCTATCTTTGTCACGAGTGAATTGTTCTCAGTTTCTCGGTTTATGTGCTCTTCCAGGTTGTAAATTTAAAGATGTTAGAAGAAATGTCCAAAAAGATACAGAAGAACTAAAGAGCTGTGGTATACAAGACATATTTGTTTTCTGCACCAGAGGGGAACTGTCAAAATATAGAGTCCCAAACCTTCTGGATCTCTACCAGCAATGTGGAATTATCACCCATCATCATCCAATCGCAGATGGAGGGACTCCTGACATAGCCAGCTGCTGTGAAATAATGGAAGAGCTTACAACCTGCCTTAAAAATTACCGAAAAACCTTAATACACTGCTATGGAGGACTTGGGAGATCTTGTCTTGTAGCTGCTTGTCTCCTACTATACCTGTCTGACACAATATCACCAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGGGCAATACAGACCATCAAGCAATACAATTATCTTCATGAGTTTCGGGACAAATTAGCTGCACATCTATCATCAAGAGATTCACAATCAAGATCTGTATCAAGATAA Translation Sequence: MKPPSSIQTS EFDSSDEEPI EDEQTPIHIS WLSLSRVNCS QFLGLCALPG CKFKDVRRNVQKDTEELKSC GIQDIFVFCT RGELSKYRVP NLLDLYQQCG IITHHHPIAD GGTPDIASCCEIMEELTTCL KNYRKTLIHC YGGLGRSCLV AACLLLYLSD TISPEQAIDS LRDLRGSGAIQTIKQYNYLH EFRDKLAAHL SSRDSQSRSV SR Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 005183
Form: Supplied as a lyophilized powder.