CENPA cDNA

Catalog Number: USB-551877
Article Name: CENPA cDNA
Biozol Catalog Number: USB-551877
Supplier Catalog Number: 551877
Alternative Catalog Number: USB-551877-10
Manufacturer: US Biological
Category: Molekularbiologie
Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. CENPA encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. CENPA is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4) 2 tetrameric core of the nucleosome particle. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 423bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGCCCGCGCCGCCGGAGCCGAAAGCCCGAGGCCCCGAGGAGGCGCAGCCCGAGCCCGACCCCGACCCCCGGCCCCTCCCGGCGGGGCCCCTCCTTAGGCGCTTCCTCCCATCAACACAGTCGGCGGAGACAAGGTTGGCTAAAGGAGATCCGAAAGCTTCAGAAGAGCACACACCTCTTGATAAGGAAGCTGCCCTTCAGCCGCCTGGCAAGAGAAATATGTGTTAAATTCACTCGTGGTGTGGACTTCAATTGGCAAGCCCAGGCCCTATTGGCCCTACAAGAGGCAGCAGAAGCATTTCTAGTTCATCTCTTTGAGGACGCCTATCTCCTCACCTTACATGCAGGCCGAGTTACTCTCTTCCCAAAGGATGTGCAACTGGCCCGGAGGATCCGGGGCCTTGAGGAGGGACTCGGCTGA Translation Sequence: MGPRRRSRKP EAPRRRSPSP TPTPGPSRRG PSLGASSHQH SRRRQGWLKE IRKLQKSTHLLIRKLPFSRL AREICVKFTR GVDFNWQAQA LLALQEAAEA FLVHLFEDAY LLTLHAGRVTLFPKDVQLAR RIRGLEEGLG Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001800
Form: Supplied as a lyophilized powder.