The protein encoded by CIB2 is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 564bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAGGACTGCACCTTCTTCAATAAGAAGGACATCCTCAAGCTGCATTCGCGATTCTATGAGCTGGCCCCCAACCTCGTCCCAATGGACTACAGGAAGAGCCCCATCGTCCACGTGCCCATGAGCCTCATCATCCAGATGCCAGAGCTCCGGGAGAATCCCTTCAAAGAAAGGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAACCTCACTTTCAACGACTTTGTGGACATGTTTTCCGTGCTCTGCGAGTCGGCTCCCCGAGAGCTCAAGGCAAACTATGCCTTCAAGATCTATGACTTCAACACTGACAACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCCCGGCTCACTAAGTCAGAGCTGGATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGCTGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCACTTTCCACATCCGGATCTGA Translation Sequence: MGNKQTIFTE EQLDNYQDCT FFNKKDILKL HSRFYELAPN LVPMDYRKSP IVHVPMSLII QMPELRENPF KERIVAAFSE DGEGNLTFND FVDMFSVLCE SAPRELKANY AFKIYDFNTD NFICKEDLEL TLARLTKSEL DEEEVVLVCD KVIEEADLDG DGKLGFADFE DMIAKAPDFL STFHIRI Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
