COTL1 encodes one of the numerous actin-binding proteins which regulate the actin cytoskeleton. This protein binds F-actin, and also interacts with 5-lipoxygenase, which is the first committed enzyme in leukotriene biosynthesis. Although COTL1 has been reported to map to chromosome 17 in the Smith-Magenis syndrome region, the best alignments for this gene are to chromosome 16. The Smith-Magenis syndrome region is the site of two related pseudogenes. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 429bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCACCAAGATCGACAAAGAGGCTTGCCGGGCGGCGTACAACCTGGTGCGCGACGACGGCTCGGCCGTCATCTGGGTGACTTTTAAATATGACGGCTCCACCATCGTCCCCGGCGAGCAGGGAGCGGAGTACCAGCACTTCATCCAGCAGTGCACAGATGACGTCCGGTTGTTTGCCTTCGTGCGCTTCACCACCGGGGATGCCATGAGCAAGAGGTCCAAGTTTGCCCTCATCACGTGGATCGGTGAGAACGTCAGCGGGCTGCAGCGCGCCAAAACCGGGACGGACAAGACCCTGGTGAAGGAGGTCGTACAGAATTTCGCTAAGGAGTTTGTGATCAGTGATCGGAAGGAGCTGGAGGAAGATTTCATCAAGAGCGAGCTGAAGAAGGCGGGGGGAGCCAATTACGACGCCCAGACGGAGTAA Translation Sequence: MATKIDKEAC RAAYNLVRDD GSAVIWVTFK YDGSTIVPGE QGAEYQHFIQ QCTDDVRLFAFVRFTTGDAM SKRSKFALIT WIGENVSGLQ RAKTGTDKTL VKEVVQNFAK EFVISDRKELEEDFIKSELK KAGGANYDAQ TE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.