COX6B1 cDNA

Catalog Number: USB-551897
Article Name: COX6B1 cDNA
Biozol Catalog Number: USB-551897
Supplier Catalog Number: 551897
Alternative Catalog Number: USB-551897-10
Manufacturer: US Biological
Category: Molekularbiologie
COX6B1 belongs to the cytochrome c oxidase subunit 6B family and connects the two COX monomers into the physiological dimeric form. Defects in COX6B1 are a cause of mitochondrial complex IV deficiency (MT-C4D), also known as cytochrome c oxidase deficiency. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 261bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGAAGACATGGAGACCAAAATCAAGAACTACAAGACCGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACTAGAAACTGCTGGCAGAACTACCTGGACTTCCACCGCTGTCAGAAGGCAATGACCGCTAAAGGAGGCGATATCTCTGTGTGCGAATGGTACCAGCGTGTGTACCAGTCCCTCTGCCCCACATCCTGGGTCACAGACTGGGATGAGCAACGGGCTGAAGGCACGTTTCCCGGGAAGATCTGA Translation Sequence: MAEDMETKIK NYKTAPFDSR FPNQNQTRNC WQNYLDFHRC QKAMTAKGGD ISVCEWYQRV YQSLCPTSWV TDWDEQRAEG TFPGKI Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001854
Form: Supplied as a lyophilized powder.