DBI encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 264bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTCAGGCTGAGTTTGAGAAAGCTGCAGAGGAGGTTAGGCACCTTAAGACCAAGCCATCGGATGAGGAGATGCTGTTCATCTATGGCCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAGGCCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACAAAGTAGAAGAGCTAAAGAAAAAATACGGGATATGA Translation Sequence: MSQAEFEKAA EEVRHLKTKP SDEEMLFIYG HYKQATVGDI NTERPGMLDF TGKAKWDAWN ELKGTSKEDA MKAYINKVEE LKKKYGI Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.